Commit 61a71e56 authored by Gabe Gomez's avatar Gabe Gomez

Add p1.c file

parent 9a5683c7
#include <stdio.h>
#include <string.h>
int main(int argc, char const *argv[]) {
char dna[1000] = "AGTCGTGAATTCCAAATTTTGGGCGATATAGCTAGGATATCGCGGGATTATCGAGACGAGGGGAGAATTTTTTTTTCCCCCCAAGG";
int length = strlen(dna);
int i = 0;
int a = 0;
int c = 0;
while (i < length - 1) {
if (dna[i] == 'A') {a++;}
else if (dna[i] == 'C') {c++;}
i++;
}
return 0;}
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment